Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAC11YB03FM1
Length(NT) : 704
Best Gene Model Blast : Link to GSTUMT00004813001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein An15g06750
Accession: ref|XP_001397203.1| Score: 211 E_value: 2e-15
KEGG Definition: hypothetical protein
Accession: ang:An15g06750 Score: 211 E_value: 1e-15
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAC11YB03FM1
TTGGAAAAGATTTACTCCCCTATAAACCTACTCTCCACCCCTCTTTTAGC
CCGCGAACACTACCACGGACACCGAGAACAAGAGGAACAATAGGCAAGAC
AACATGGATTCTGCAGCATATCAAAACCCGTACATTACTACGAACAACAA
TGTCGGCAATGCGACGGACAGTTTTAATGTGTGGAACAGCTTTAACCGCG
AGACATCGATATTGGATAAGAAGCGCCAGATTCTGGAGTGGTTGTCTCCC
TTGGCCCCAAGGGAGAGGCACCAGATTGCGAGAGAGGGCCTGGTGGATGG
AGTAGGAGACTGGCTTCTCCGAACGAGCGAGTTTGAGAAATGGCACACAA
GCGAGGGTCAGACTGTCATTCCTGTGTTATTCTGTTATGGGGACCCAGGG
GTGGGGAAGACATATATGAGCTCTCTTGCGATAGATACATTGTGCGATGC
GATCGGTGGGGACAATGTGGCTGTCGCTTGCGTATACTGTGATTTCCATG
CCTATAAAGCGCAATCCGCGACCAGTGTGTTAGCGGTCCTCTTGAAGCAA
CTTGTCGCAGGATTGGAACCGGTTCCGGGAGAGATAAAAGGGGCCTTTGA
ACAAGCAAAGAGGAAGGTGGACGGTCGGGCGCTCCGGCTCACTGAAATCC
GCACGATGCTGGCCATCCCTCTCATCTTTACGCCGAGGATTTTTCTGCAT
TGAC

Sequences in the Contig:

SY0AAC11YB03FM1