Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAC11YA14FM1
Length(NT) : 695
Best Gene Model Blast : Link to GSTUMT00010270001 E-value : 1e-146
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein FG05500.1
Accession: ref|XP_385676.1| Score: 293 E_value: 7e-25
KEGG Definition: hypothetical protein
Accession: fgr:FG05500.1 Score: 293 E_value: 3e-25
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAC11YA14FM1
TTGGAGAAAGCCAGCATCGCTCCCAATTTCTCCACCGCAAAAATACACCT
ACCTTTCATCACCTTCGCACTTCATCTTCCCTCTACTCTTTCTGGTGACT
TCTACAACGTTTCCATATTTCGGTGGACTTGTGAACTTTTCTCCTACCGG
TTATGGCTACTGCGCACGAGCAGTCAATGAACGCCTCCAGGTGAGAGTCA
TTAACACTACCGCTTTGCGACCTCACGCTTTTTGTGCTAACTATGGGCTC
CGCCGGCAGTGCCATTCCTCTCCCGGAAATTCCTGTAAAACTGCGATGTA
CCATCTGTAGCGAGCTCGCAAGAGGCGCATCTCGTCTACCTTGTTGCGAA
CAATCGATATGTGAAAGCTGTCAGTTATTTCTCTCCCTCTCAGATTAATC
ACCATAGCTGGATAGCAGCCAACTCTAAAACTCAGGTCGATCAAAACTAC
CGGATGTCTGTCCGGTCTGTGACCACTCTCCGCTCGGTGCCAGCGATTGC
AAACCGAATGGAGCCTTGAGGACCACGGTGGCGGTGTTTTTGCGAACCGC
GGAGAAAAAGCATAACTTGTCGATGCAAAAGTTACAGAAGGAACAGGCAA
AGCCTGTTGAGCCTCAGTCAGAGGCGAAAGTCTTGGAGCCAAAACCAGAA
AAGCCTCAACCGACTCACGCTTCTCCTGTCGTTAATCCATTAACT

Sequences in the Contig:

SY0AAC11YA14FM1