Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAC10YP09FM1
Length(NT) : 650
Best Gene Model Blast : Link to GSTUMT00005526001 E-value : 1e-129
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CHGG_00583
Accession: ref|XP_001219804.1| Score: 396 E_value: 7e-37
KEGG Definition: hypothetical protein
Accession: mgr:MGG_00686 Score: 378 E_value: 4e-35
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG3043 Score: 167 E_value: 6e-13
PFAM Definition: DLH, Dienelactone hydrolase family..
Pfam Number: pfam01738 Score: 112 E_value: 2e-06
Swissprot: P39721|YAE9_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0042802 = Molecular function: identical protein binding

Sequence:
>SY0AAC10YP09FM1
TTGGGAACGCAAAAAAATGATGGATGAAGCCCCCTCAAAAGCGCCCCCGG
CTCCTACCGTTGAGGCATCGGTCGAAGCTCAGGTTAAAGCCCCGCAGCCT
CGTATGAGCGACCATTGCACGAACGATGCTCCACTCGATATTTCGGAGGT
TGCTGCTGGTGTTTATGTTTCTAAGCCAGAGGGAGTGTTTTCCAGCGCCG
CTAGGCTGGTCCTCCTATTGACCGGCGGAACCGGCATCACGGCGAAGACA
AACCAGATACAGGCAGATCATTTTGCTCGGAAGGGATACTTTGTTGTTAT
GCCTGATCTGTTCAATGGCGATTCGGCTCCTAATGCCGCTGCAGTAACAG
CACATACCGAAAATGCGGATCTTCTCGAGACAATAAAGTTTAGAGCCGCG
GAGGGTATCAAGGGTTTTATGATCGATATGTGGCTTGCTCGCCATACTCC
TGAAAACACTATGCCGATAATAGAAAAGGTCCTGAAGGCCGTCAAGGAGA
CATACGCTGACAAGGCTTACGACGGCTCCATGGGAGTACTAGCGGTAGGG
TACTGCTTTGGAGCGAAGTATGTTTTGCGGCTTGCAGCTACCGATGGGAT
TGCTGCTGGTGCTGTTGCGCATGGACTACTGATTAGCAAGGAGGATATTG

Sequences in the Contig:

SY0AAC10YP09FM1