Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAC10YM23FM1
Length(NT) : 624
Best Gene Model Blast : Link to GSTUMT00006700001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_13387
Accession: ref|XP_001548197.1| Score: 599 E_value: 2e-60
KEGG Definition: hypothetical protein
Accession: fgr:FG11599.1 Score: 589 E_value: 1e-59
KOG Definition:
Classification: [Defense mechanisms].
Kog Number: KOG1826 Score: 209 E_value: 9e-18
PFAM Definition: No Hit Found
Swissprot: P97526|NF1_RAT
Gene Ontology:
GO:0030424 = Cellular component: axon
GO:0005737 = Cellular component: cytoplasm
GO:0030425 = Cellular component: dendrite
GO:0005634 = Cellular component: nucleus
GO:0008017 = Molecular function: microtubule binding
GO:0030036 = Biological process: actin cytoskeleton organization and biogenesis
GO:0030325 = Biological process: adrenal gland development
GO:0048844 = Biological process: artery morphogenesis
GO:0048593 = Biological process: camera-type eye morphogenesis
GO:0021987 = Biological process: cerebral cortex development
GO:0030199 = Biological process: collagen fibril organization
GO:0021897 = Biological process: forebrain astrocyte development
GO:0048853 = Biological process: forebrain morphogenesis
GO:0007507 = Biological process: heart development
GO:0001889 = Biological process: liver development
GO:0001656 = Biological process: metanephros development
GO:0022011 = Biological process: myelination in the peripheral nervous system
GO:0043407 = Biological process: negative regulation of MAP kinase activity
GO:0043409 = Biological process: negative regulation of MAPKKK cascade
GO:0007406 = Biological process: negative regulation of neuroblast proliferation
GO:0048715 = Biological process: negative regulation of oligodendrocyte differentiation
GO:0042992 = Biological process: negative regulation of transcription factor import into nucleus
GO:0001649 = Biological process: osteoblast differentiation
GO:0014065 = Biological process: phosphoinositide 3-kinase cascade
GO:0043473 = Biological process: pigmentation
GO:0045762 = Biological process: positive regulation of adenylate cyclase activity
GO:0043525 = Biological process: positive regulation of neuron apoptosis
GO:0032320 = Biological process: positive regulation of Ras GTPase activity
GO:0045765 = Biological process: regulation of angiogenesis
GO:0045124 = Biological process: regulation of bone resorption
GO:0001952 = Biological process: regulation of cell-matrix adhesion
GO:0001666 = Biological process: response to hypoxia
GO:0048745 = Biological process: smooth muscle development
GO:0021510 = Biological process: spinal cord development
GO:0048485 = Biological process: sympathetic nervous system development
GO:0008542 = Biological process: visual learning
GO:0042060 = Biological process: wound healing

Sequence:
>SY0AAC10YM23FM1
TTGGGTGAGAAGTTGGCGGCAGCAGAGCCGCAGCTGACATTTGACTTCCT
GTCTGAATTCTTTGTCGGTTGGGAGAAGTCACACCCTCAACAGCGACCGC
TGAATATCCTTTATATGGCGCCATGGTTGGCAAATCTTCATTCACAGGTG
CTTATGGGCGGGGAGGATCCCGAGCGCGGCAAAGAACGCCTGGCAGCCAT
CGCAAGGAAGATGATTGATATTACGGTGCGGGAACCAAGGCTTTATACTT
CTTTCCAGCAGAACGCCTGGTGCATCATTAGCAAGGATGAGGGGCTATTG
GATGTGTTCTTGGATGAATTGGTTAAATCGGCAATGAACTTTGGGTTTGG
ATCGGAGGGAGCGGAGACAATTGGCTCTATCGCATCGAGTTTCGGAACTC
CGACCATCCGAGGGAAGATTATCGCAAGGATCCGGAAGGTTCTTAACAGA
TCGTCACTAAGGCCGATGAGACATCTGGTGGACAACATAGTTTGGAACGA
GATTTGCGTGTTGCTGAGACTTTGCCTTGCCATCTCTTTTGATAGCAGAG
TTCAAGCGCAAATGTATCTCCCCGAGCTCTTCCACATCATCACGATGGTC
GTCAATTGCGGATCCATCCCCGTG

Sequences in the Contig:

SY0AAC10YM23FM1