Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAC10YJ05FM1
Length(NT) : 601
Best Gene Model Blast : Link to GSTUMT00011036001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001212674.1| Score: 233 E_value: 4e-18
KEGG Definition: hypothetical protein
Accession: ncr:NCU05316.1 Score: 237 E_value: 8e-19
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAC10YJ05FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCCAACTTTTTTGTACAAAG
TTGTCCCCTGCGAAACGACTCTTTGCTACATTTCTCTGTGAAAGCATATT
TCTTCCTTTCTCGACACAGAATTGGGCTCGTCCCATTCGTTACCCAATAC
AACAGCTAGTATGAGTACGAGTAGCGAATCCGACCTAAGCGATCATGACA
CTTCTGGCGCGTTGGATGATTATACCAACACTTCCACTGATAGAAAGGAC
ATTCTTTCATGGCTCTCCACACTAGAGCCACAGAGACAGCATTCCCATGT
CTCCCACTCCCGCCTTAAAGGTGTGGGAGATTGGTTTCTAGAATCTGCTG
AATTCCAGTCGTGGCGCGACGATGATAGTGAATCTGTTGCTCGGATCCTA
TTCTGCCAGGGTGTCCCAGGGGCAGGAAAGACTTTTATCAGTTCCTTGGC
TATCGACAACTTAAGCGATATCAATGATCCTGCTAGAGCAAATATTGGAG
TGAGCTACGTATATAACAGTTACCAGGATCAGAAATATCAAGATCCGACT
GGTATGATGGGTAGTCTGCTGAAGCAATTAGTGGCTGGGCTGCCAGATGT
G

Sequences in the Contig:

SY0AAC10YJ05FM1