Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAC10YI11FM1
Length(NT) : 465
Best Gene Model Blast : Link to GSTUMT00006148001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein FG07201.1
Accession: ref|XP_387377.1| Score: 203 E_value: 7e-15
KEGG Definition: hypothetical protein
Accession: fgr:FG07201.1 Score: 203 E_value: 3e-15
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAC10YI11FM1
TTGGCCCTCAACCCCACTTCATCCCAATCCAATCCCACACAATGCCAAAT
CGCCCAGATCCGCACGCAGGCAACCCCGACCACGCCGCCCTCGAAGCCAC
CAAAGGCGCCGTTAGTGGCGCAATCCGATGGGGCGCAGTCTCCTTCCTAG
CCGGCGTAGCAGCCTACTTCTCCAGCCCTATTTTTCGTAACCTGACTGTG
CAGTTCAAAGTCTATCTATGGATGTGTCCAACTGTTGTCGGGAGTATGAT
TGAGGCTGATAATCGGTTGCGGGGCTACGAGGGTATGATACGTAGGCGCA
GGCGCGCTGCCATGGAGGATGCGCGGGAGCGGGCATACGTGAGGGAGATT
GAGGAGTTGGAGAGGAGGAGGGGGGGGTGAGGAGTGTATGCTGTATGATG
TGACGAGGTATTATAGATTCATAGGGGGGGGGTTGGTATATCATCATTTG
GTCGTTCGGGACTTT

Sequences in the Contig:

SY0AAC10YI11FM1