Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAC10YH24FM1
Length(NT) : 613
Best Gene Model Blast : Link to GSTUMT00010799001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE64562.1| Score: 234 E_value: 3e-18
KEGG Definition: ankyrin
Accession: aor:AO090138000202 Score: 234 E_value: 2e-18
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAC10YH24FM1
TTGGGCCCTAGCTGTTGAAATAGGGTCACCGAATCTGAATACCGATAATG
TTCCTTCAATAGGGACATTACTAGCCTGTTGTCAAGGACTTGTTGTGGTA
GACAAGGAGTCTTCCACGGTTCGCTTAATCCATATTACCCTTCATGAGCA
CCTCCGGGATCATCCGGAGTTTTTTGGCACACCTCACTCGACAATGGCAG
AAACTTGCTTAAGTTATCTAAATTCGCAGCAGGTCAAGGTCCTTTCGACA
AGTCCCTCTCCCGACTTCCAAGACACACCCTTTCTTGGGTATTCTTCTCT
ATATTGGTGGGTACACGCAAAAAAGGACCTTTCAGATCGCGCGAAAATGC
TCGCATTAAAGCTATTTAGCGACTATGATAACCACCTATCCACTAAAATC
CTCTTGAGAACATGGAAGCCGCATTTATGCACTGTTGGTTTCGATAAACC
CTCCCTGTTCAGTGGCCTACACTGTGCATCCGTCTTCGGGATTGCTGAGA
TTGTAGCTAGTTTGGTAGAGGTGGAAGGCTGCAAGATCGACCAACAAGAC
TGCACGGGCAATACACCTCTTATGTAGGCTACTCGGAACGGGCATGAGGG
ACTGGTCAAAACA

Sequences in the Contig:

SY0AAC10YH24FM1