Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAC10YB07FM1
Length(NT) : 665
Best Gene Model Blast : Link to GSTUMT00009802001 E-value : 8e-46
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001404174.1| Score: 131 E_value: 4e-06
KEGG Definition: hypothetical protein
Accession: fgr:FG02646.1 Score: 131 E_value: 2e-06
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAC10YB07FM1
TTGGGCAGGGTGCGGTTGAGGAAGGAAGCGTGCGTGAAGTTGTGTGTTGA
GAGTGTGAGTCTGAAGCTGTGCGCATGAATGTGTGAAACGACATTGTCGT
GTGAGAGGAAGTGCTGAGTAGGGTTGGGAAGGTAGAGAGAACGAGATCTT
CAATCAGAGGAAATCGCCAGTATTTCAGATATTCGAATATTCGTCATGTC
TTCGTTGTCTCGCAGAGCCTGTTACAAGTCTGTTACCTTCCTTTCCTCCC
TGGCGTGTCTTCGTATACCACCAGGATTGCCCAATTTCTGACATTCTTCG
CTTTCCCCCCCTCTCAGATGTGGATCCATCGGCCACTTTGCTGAGGTTTG
TTCATCGCCTGAGCGCCTTTGTTACAATTGTAAGAGATCGCCTTGCTTTT
TCCATTTCATCTGGGGGAGAATGAGGGGGAGGGGTTCTTTCAGAATTTTG
GAATTCTCCGGACATAGATATCCATCTAAGATAGGGCTGGTGTGGGGATG
CTGACGTGTTTTTGTGGGTACAGGCAAGCAACCGGGTAAGCACCATCTGG
GTCGCCGTTATTTTCTAATTGATTTCCCTCTACCTTGACAGACGGTCATA
CTCAACTGCAGATATATGTTGAATTAGGACACGAATCCAATGGATGCCCG
AACCCGAGAACTACC

Sequences in the Contig:

SY0AAC10YB07FM1