Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAC10YA19FM1
Length(NT) : 625
Best Gene Model Blast : Link to GSTUMT00003001001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_04616
Accession: ref|XP_001556900.1| Score: 331 E_value: 2e-29
KEGG Definition: asparagine synthase
Accession: aor:AO090009000460 Score: 312 E_value: 2e-27
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG0573 Score: 231 E_value: 2e-20
PFAM Definition: Asn_synthase, Asparagine synthase. This family is always found associated with pfam00310. Members of this family catalyse the conversion of aspartate to asparagine..
Pfam Number: pfam00733 Score: 108 E_value: 4e-06
Swissprot: O74397|YOCB_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>SY0AAC10YA19FM1
TTGGGGATGGACATGAGGGGTGGAAAGAGGTGGAGGCTTATGGGTTGCGG
TATTTCAGTTTGCAAAGTGGAGAGGAGGGGGTTGTGCCATTTTTGCACCG
AGAGGATAGGGATGGGGGTCAAGTTTCAATGGAATTGCCTTTCCCTAAGC
TCAACCGGAATATCGAACCAGACGGACGCTTAAATACTGATTCTCCAGAG
GTTGGAAAGCTCAAGGAGGTTCTACTGGGGAGCGTCCGAATAAGAGTCGG
CGACATCCCCGAGCCCCCGGGCCCCGGAAGAAAAGTTCGACTAGCGGTAC
TTTTCTCTGGTGGTCTTGACTGCTCAGTAATAGCCCGGCTCGTGCACGAA
TGTCTACCACTAGATGAAGCCGTTGATCTCTTAAATGTAGCATTCGAAAA
CAGGCGCTTTGTCGAAGCACGAAACAAAGCGAACAAGGCTAACAAACCTA
AACGCCGGACCCAGCATCCAGAAGCGGCGGCCCCACCCGAAGATCCTCAA
CGGGAAGGCGCCGTAGATCCGTATTCCATCTGCCCCGACCGAATAACCGG
CCTAGCCACCTATGACGAGCTGCAAAAAGTTTGCCCCGGCCGTCTCTGGA
ACTTCATACAAATCAACGTCCCTTA

Sequences in the Contig:

SY0AAC10YA19FM1