Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAC10YA11FM1
Length(NT) : 666
Best Gene Model Blast : Link to GSTUMT00008882001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: TATA-binding protein associated factor Taf2
Accession: ref|NP_593331.1| Score: 612 E_value: 6e-62
KEGG Definition: hypothetical protein; K03128 transcription initiation factor TFIID subunit D2
Accession: spo:SPAC3A12.05c Score: 612 E_value: 3e-62
KOG Definition:
Classification: [Transcription].
Kog Number: KOG1932 Score: 486 E_value: 8e-50
PFAM Definition: No Hit Found
Swissprot: P23255|TAF2_YEAST
Gene Ontology:
GO:0005669 = Cellular component: transcription factor TFIID complex
GO:0016251 = Molecular function: general RNA polymerase II transcription factor activity
GO:0005515 = Molecular function: protein binding
GO:0000114 = Biological process: G1-specific transcription in mitotic cell cycle
GO:0006367 = Biological process: transcription initiation from RNA polymerase II promoter

Sequence:
>SY0AAC10YA11FM1
TTGGCTCGAACACTTACATACTCGCTTGCCGCACAATGGGCCGGGGTTCA
TGTAGTTCCAAAGGATTGGTCTGATACATGGGTTATTGTTGGGATGGCAT
ATTGGATGGCCAACTGTTTTCTGAAGACCCTGATGGGTAATAACTGGTAC
CGGTTCAACCTCAAGAAAGATGCGGAGAAGATCTGCGAACTGGACATCGG
AAGACCATCCCTCTACGCTCAAGGATTCCAAGTCCCAATTGAGCCATCCG
CCCTGGACTTTATCAAACTTAAGGCGCCAGTTGTATTGACGATATTGGAA
AAGCGATTGTGGAAGGTTAGCTCCTCAATGGTATTGCACCGCGTGGTTCG
AAAAACCTTTCTTGGAGCAATTGCAGGCGATTTGAAGAATGGCTTAATGA
GCACTCAACATTTCACCCGGTTGTGTGAGAAGAACAGTCACACCAAACTC
GAATCCTTCTTTCAGCAGTGGGTATACGGTTCTGGTTATCCACGGTTTGA
AGTCTCCCAGCGCTTTAATAAGAAGAGGATGATTGTAGAGATGGGTATTC
GACAGGTGCAGTCGTCGGAGACTCCGGCCGCACGAGTGACGGCTGAAAAC
TTTATGCAGGACGCGATGAATCACGAGCGCCATATTGTTGTTGGTCCTAC
AAGGCCTGTCTATACT

Sequences in the Contig:

SY0AAC10YA11FM1