Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB9YP08FM1
Length(NT) : 574
Best Gene Model Blast : Link to GSTUMT00006606001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: Ankyrin repeat protein
Accession: gb|EDP48589.1| Score: 374 E_value: 2e-34
KEGG Definition: ankyrin repeat
Accession: aor:AO090010000141 Score: 333 E_value: 5e-30
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG4412 Score: 266 E_value: 2e-24
PFAM Definition: No Hit Found
Swissprot: Q9ULJ7|ANR50_HUMAN

Sequence:
>SY0AAB9YP08FM1
CATAGCATATTGGGGGATTGAAGAAATTGCAGTCGCCATGCTAGATATGA
AAAGGTGGGACATCAATGGAGAAGATTCAGCGGGAGACACACCATTAAGT
TGGGCTTTGCAATGTGGGAAGGGCAAGGTCGTGCAACCATTTTCAGAGCA
GGGAGGTATTGAACCAGACAAGGTTATTCGAAGCGGTCGTACAGTGTTAT
CGTTCGCCGCTGAGTTGGGGAATGAAAGTGTAGTAGAGCTGCTTCTAGAG
CTGGGGGATGTCGATCCGGACTCGATAGATGAGGGTGGGCGAACACCACT
ATCATATGCCGCTGGGTGTGGGAGAGAAGGTATAGTCGAGTTACTCCTGG
AGAGCGGGGATGTCCATCCCGACTCAGCAGATAAAGATGGGCGAACACCG
CTATCATATGCCGCGAATTCGTGCCGTGAAAGTGTAATCAGGCTATTTCT
GGAGCGCGGGAATGTCACTGCCGATTCAGCAGACAATGGAGGACAGACAC
CACTATCATATGCCGCAGAGTATGGGCATGGAGGTGTAGTCAAGCTATTT
CTAGAGCGCGGAGATGTTAATTTC

Sequences in the Contig:

SY0AAB9YP08FM1