Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB9YL11FM1
Length(NT) : 669
Best Gene Model Blast : Link to GSTUMT00004749001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein
Accession: ref|XP_502233.1| Score: 197 E_value: 8e-14
KEGG Definition: hypothetical protein
Accession: yli:YALI0D00253g Score: 197 E_value: 4e-14
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q12104|YO166_YEAST
Gene Ontology:
GO:0005634 = Cellular component: nucleus
GO:0006351 = Biological process: transcription, DNA-dependent

Sequence:
>SY0AAB9YL11FM1
TTGGGACCGTGCCAGTGAGAAAATTGGTCAGGGACAGCTAGAAGTTCTAG
TGCCCGGTCAGCGCGTTGACGATGCTACCCATATCCTCGTAATTGATACA
AGTTTTATTCTGGTTCATCTTAACTTGGTTAACGATCTTGTGCTTTCATA
CTTGGAGTGGGGCTGTGTCGTAGTTTTGCCCTGGGCCACTATCCAAGAAC
TAGACGGGCTCAAGAAATCAAGCAGAGGTATCACCGGTATTAGCTTTGGA
AATGACGGCCGTCGGGTTGATATATCTATGCTCGCACGTGCGGCAAATCG
CTGGGCATTTCGGGTCCTGTCAAATCCGGAACCAGGAATATGGGGGCAGA
CAAGGGAAGAGGTTATTAACAGGACTTTCAATCACGGCGACATGGCCATC
TTGGACTGTGCTAGATTTTTCTACGATCAAGGGTATGATACTTATCTCCT
GACTAATGATTTTAATCTCAGCGTGAACGCTATAATTTATAAAATTAAGG
CGTTTATGTACGAGAAAGGGCAGACTTGCCATTCCCTATTGAAGAAGATT
TATGGGAGATCTCGAAGACCCCGCCATCTCCCGAAACCCAGAGGGTTTTT
GGCTCAACCTACTGGACCCAAGGTTCAACAAAGGCCTGGGGACTGGGTTG
GGTCGAGAATTGTACCAGG

Sequences in the Contig:

SY0AAB9YL11FM1