Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB9YI06FM1
Length(NT) : 689
Best Gene Model Blast : Link to GSTUMT00007356001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001539263.1| Score: 297 E_value: 2e-25
KEGG Definition: hypothetical protein
Accession: spo:SPAC1039.05c Score: 248 E_value: 5e-20
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q9US36|YFZ5_SCHPO
Gene Ontology:
GO:0005634 = Cellular component: nucleus
GO:0005819 = Cellular component: spindle

Sequence:
>SY0AAB9YI06FM1
TTGGCTTTGATCTTCGCGTGCTGCACCTGCCATGCGAAGAGTTCCTCTGG
AATGCGGATTCCTCGCACGAATGGGTGGGATACCTCGACGGGCAGCAGGA
GCACCCAAGCTTCCTGGAGATGCTGCGCGTCTTCCTCGACCCCAAGAGGC
AGTTTCCCGTGCTGTCGCCGCTTAGCTCGATGTTCATTCTGCACGGCTTG
ATATCGGTTGGCTACGACCTTCACAGGAGATCATCGCCCATCGGCCCGAG
CCCCGAAGAGACAGCTGCGAAGCAGGCCAGGCTGTTGAGGGCATACGAGA
AGTGGGCGACTTACTACGAGATGAATGTGAGCCAACACTTGTCCCAATCC
TGTAACAACAAGAACATGGTCATGTACCATGCCGCCTACATCTCTCTACA
CACAAACATCCACAACCTGACTACCGTGGCCGGGGATACCCGGACCTTCA
AGAGGAACCCAGAGAGGGGCGACTACTACAGAGCAAAGGCGGAGCTTCAG
CAATGGGCAAACAGCAGATCCGCACAACTCGCTACATGGCACGCGGCGCA
GATTCTGGTTAGGTCATTGGATCGCACGCACGTCTATCTTGATTTGCTTC
ATGTTCCGTGGTGCATGTACATAGCAACTTTGGTCTGCTGGGCGTATGGG
CAATTTTCATCCTCGGTCGTCGGGCCAGGGGGATTATCT

Sequences in the Contig:

SY0AAB9YI06FM1