Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB9YH18FM1
Length(NT) : 466
Best Gene Model Blast : Link to GSTUMT00006279001 E-value : 1e-108
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein AN5526.2
Accession: ref|XP_663130.1| Score: 205 E_value: 5e-18
KEGG Definition: hypothetical protein
Accession: ani:AN5526.2 Score: 205 E_value: 2e-18
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG3408 Score: 176 E_value: 4e-14
PFAM Definition: No Hit Found
Swissprot: Q08004|BUD20_YEAST
Gene Ontology:
GO:0005634 = Cellular component: nucleus
GO:0000282 = Biological process: cellular bud site selection

Sequence:
>SY0AAB9YH18FM1
TTGGGGCGAGTTTCGCAAGGGAGCGAGAGGAAGAAAACAAAACAAAAGAA
ACAGTGAGAGAGTTGGCCCACTTCCGGGACAAGCCACTTACACACCGGTA
CCATCTAATTTTCCACGATAACAACAAGTCGGGTCGAGATAACCATGGGT
GCTATTCGCCGTTCAAAGACGAAGCGTAGAACTCGGTATGGGAAGTGATA
TGGACCAAGTTCATTCCGACCTCCGCGATCCGAAACAGCTTGCTCAACTT
AAGGCTTTGGTCCCGGATGAGGATAAACCAGGCCTTGGGCAATTCCATTG
CGTTGAATGTGCAAAGTACTTTGAGAGTGAATGGAATATGGTGCAGCACC
GTCGTGGCAAGAACCATAAACGGAGGTATGATAATAAATATTTCAGAGCC
TGTTTTTCCGCATCTTTTCCCACCATTTCTTGGGGCGATTGGATGGCCTG
ACTTTGTGTTGGGCGT

Sequences in the Contig:

SY0AAB9YH18FM1