Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB9YH17FM1
Length(NT) : 589
Best Gene Model Blast : Link to GSTUMT00011731001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein FG06113.1
Accession: ref|XP_386289.1| Score: 200 E_value: 3e-14
KEGG Definition: hypothetical protein
Accession: fgr:FG06113.1 Score: 200 E_value: 1e-14
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG3116 Score: 111 E_value: 2e-06
PFAM Definition: Rrp15p, Rrp15p. Rrp15p is required for the formation of 60S ribosomal subunits..
Pfam Number: pfam07890 Score: 155 E_value: 1e-11
Swissprot: Q06511|RRP15_YEAST
Gene Ontology:
GO:0005730 = Cellular component: nucleolus
GO:0000466 = Biological process: maturation of 5.8S rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)
GO:0000463 = Biological process: maturation of LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)

Sequence:
>SY0AAB9YH17FM1
TTGGCAACAAACGAACAGAGCAAACCAACCAGCAAAACAAGCAGACACAA
TGCCATCGCATGCCACCAAAAAACGCAAAACCAGCGCCACCACCGCGGAT
GTCAAGAGGAAAAAAATCTCTGTCAAGAACAACCCTGCGAGTCCTAGCAC
ATCATCATCATCATCATCCGACAGCGAATGTTCCACCGATGCCGGCGGTG
TGGACCTAAACGAAACCTCGGACGCATCAGACCCAGAAGCCGACGAGTAC
TCCCTATCTTCCTCTGCTAGCGCTACGAATTCCGAATGTGGCGCCGACTC
CGATGACAACCTCTCCGACCTTCTCTCCGCCCCGCATCCTACAAAAAAGC
GTAGGCGCAACGACCCCGAAGGCTTCTCCACGGCAATGTCGAAGATCCTC
TCCTCGCACTTGACCACGACGGCGCGCAAAGATCCCGTACTCGTCCGTGC
GAAGCACTCCGCGGCGGAGGTTGACGAGAGCAAGATCGAGGCGAAGGCTC
GCAGAGTTCTGCGCGAGGAGAAGAGGAAGGGGTTGGAGAAGGGGCGGGTG
AAGGAGGTTGTGCCCAAGGGTGATGATGAGGCGGCGGGG

Sequences in the Contig:

SY0AAB9YH17FM1