Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB9YF21FM1
Length(NT) : 585
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB9YF21FM1
TTGGGGACAAGGCATATAGAAGACTTGAAATCGTCCTCATCAATCCATTG
ACACACTTATACCCCTTTTCCTCCATGACTGTCCCCATTTTCTTGCTTAC
TGTTTGGGGTCGTGGATGTTGCTCGAAATGCTCTGAACATGCTTGATATG
CTCGGAACCTGCTGGAAATGGTTGAGTGCTCAGGATGTTGTTTTCCTTGT
TCAGATAAAGGTTTCGGAGACACGCTTGGGTTAACAAATCCGTGAGGGGC
AAACACGTACCCCCCTGGAGCAAATAGGATGCGGTGCGGAAGCGTCAAGG
GAGCGAAGGGCACGGCGGTGGCTGCCCAGAAGCTGCGGGGAGTGAGAGAC
TCTATGAAGGCTATCTTTTATTTTGATAATATGGGAGTACAGTACGCAGA
GGAAAGAGGGACTCGTGTGAATCAGAATGGATATGTGTGGTGATCGGTGG
AAGATCGGTGGGTGCTTTTGTCACGGTTCATATATACTCTTAATTTCTAT
ATTTTGTTCATTGATTTTAATTTTAATTCTTCTACTTTAGCGTTCTAGTA
ACTTTATCATGTATCATACAGTTGTTCTATCGCAA

Sequences in the Contig:

SY0AAB9YF21FM1