Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB9YF17FM1
Length(NT) : 681
Best Gene Model Blast : Link to GSTUMT00002132001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_07739
Accession: ref|XP_001591114.1| Score: 359 E_value: 1e-32
KEGG Definition: hypothetical protein
Accession: mgr:MGG_10832 Score: 347 E_value: 2e-31
KOG Definition: No Hit Found
PFAM Definition: SPC25, Microsomal signal peptidase 25 kDa subunit (SPC25). This family consists of several microsomal signal peptidase 25 kDa subunit proteins. Translocation of polypeptide chains across the endoplasmic reticulum (ER) membrane is triggered by signal sequences. Subsequently, signal recognition particle interacts with its membrane receptor and the ribosome-bound nascent chain is targeted to the ER where it is transferred into a protein-conducting channel. At some point, a second signal sequence recognition event takes place in the membrane and translocation of the nascent chain through the membrane occurs. The signal sequence of most secretory and membrane proteins is cleaved off at this stage. Cleavage occurs by the signal peptidase complex (SPC) as soon as the lumenal domain of the translocating polypeptide is large enough to expose its cleavage site to the enzyme. The signal peptidase complex is possibly also involved in proteolytic events in the ER membrane other than the processing of the signal sequence, for example the further digestion of the cleaved signal peptide or the degradation of membrane proteins. Mammalian signal peptidase is as a complex of five different polypeptide chains. This family represents the 25 kDa subunit (SPC25)..
Pfam Number: pfam06703 Score: 252 E_value: 9e-23
Swissprot: Q04969|SPC2_YEAST
Gene Ontology:
GO:0005787 = Cellular component: signal peptidase complex
GO:0005515 = Molecular function: protein binding
GO:0045047 = Biological process: protein targeting to ER
GO:0006465 = Biological process: signal peptide processing

Sequence:
>SY0AAB9YF17FM1
TTGGCCACCAACAAAGCACCTTCGAAATTTCTCGAAAATGGCAGCAAAGC
CCAAAGCTAACCTTCATGCCCTCCCAGAACTGAAGAACACATCCGATGAT
TCTATAGCTCTCTATCTAAAATCAAAAGGCTGGAAGCAAAACCACACTCT
CACGGATGTCCGCCTTGTCTTGGGCTTCTCTGCCGTCATAATCGCCGGAG
GCACCTTCTATTATGATTACACTCTCGGCTTCGATAAGACAAAGGTCATG
ACTTTATATGCTGTGATCGCCTATTTTGTCGCCAACATAATTCTCACATG
GTGGATATGGGGTATGGAAAGCGGTAAGGTTTATGTGGGTTCAAAAGACG
GCGTCACTATCACTATATCGTCACACACCGAGAAGCATTCACCAATCTAC
CATCTCAAAATTGTTTCTCGATCGCCGGGACAGAGGCCTACTACGACCGA
AGTAGAGAGTCCCTTCACCAGCTGGTTTGATACACAGGGATTCCTTGTGG
AGAAGCCATTCATGACCTTTATATCAAATTCCATCCCCTCGATGGCAGCA
ACAACCCCCGAGGGACAGCACCTAAAATCCAAACCGAAACCGAAAAGCAC
GAAGAAGGCTTAAATTGATCGAATCGGCTGTGTCGAGACTGAAAATAAAA
ATGGGTCTACAGATTCCATCACTACCGTGAA

Sequences in the Contig:

SY0AAB9YF17FM1