Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB9YE12FM1
Length(NT) : 693
Best Gene Model Blast : Link to GSTUMT00005351001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: Pfs, NACHT and Ankyrin domain protein
Accession: ref|XP_749852.1| Score: 238 E_value: 2e-18
KEGG Definition: Pfs, NACHT and Ankyrin domain protein
Accession: afm:AFUA_1G01020 Score: 238 E_value: 8e-19
KOG Definition:
Classification: [Cell wall/membrane/envelope biogenesis].
Kog Number: KOG4177 Score: 172 E_value: 2e-13
PFAM Definition: No Hit Found
Swissprot: P57078|RIPK4_HUMAN

Sequence:
>SY0AAB9YE12FM1
TTGGTGAAACTCCTCGAGCTCCCAAACGAAGTCCTCCTCCTCGTTGCCGG
GTTCGTGCCCCCACCATCTCTCCTCTCCCTCCTGCGGGCCAACCACTTCA
CACACGCCCTTCTATCTCCCTTGCTCATAAATAACTTCCGCGACAACCGC
GCCCTCTGCGAGGAATACGGCTTGAGGGCGCTGTACTTCGCCGCCGAGCG
CGGGAATAAGGCCACAGTCAAAAGATTGCTCGAGCGCGGGTTATTGAAAT
ATGTGGGGGGCGGCACACTGTTGAATAGCGCTGTCGTCACGCAACCGGAT
CCGGTGCTCCGCACTCTGCTGGACTGCGGGGTCGCGGTGAACACTCGGGA
TTCGGATAGGCGCACGCCGCTGTCCATCGTCACAAGGATGGGGAGACTGG
GAGCTCTAAAAATGTTGCTGGAAAGGCCGGACACCGATGTGAACGTCGAG
GACCAAAAGCGAGAGTCTCCCATCCGGCACCTGGTCCGCAAGGGCGACGA
GGCCACGCTTAGAGCTCTCCTGCAGAATAAGCGAGTTGACGTCAACTGTC
CGTCCAAGAGTGGGTGGACGCCCATTCACGACGCCGTCAGTAGAAACCTC
CGCGTGGTTCTGCGCATCCTAATCCAAGACCCGAGGGTCGATGTCAATTG
CGTTGGCCCGAGCGGCTGGACTGCGCTGCATTTGGCGATCGGA

Sequences in the Contig:

SY0AAB9YE12FM1