Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB9YD03FM1
Length(NT) : 599
Best Gene Model Blast : Link to GSTUMT00009382001 E-value : 1e-106
Numbers of ESTs : 1

Blast Results:

Nr Definition: ATP dependent RNA helicase (Dbp5)
Accession: ref|XP_749257.2| Score: 119 E_value: 7e-06
KEGG Definition: ATP dependent RNA helicase (Dbp5), putative [EC:3.6.1.-]; K01529
Accession: afm:AFUA_2G01210 Score: 119 E_value: 4e-06
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q4WIN6|DBP5_ASPFU

Sequence:
>SY0AAB9YD03FM1
TTGGCTCCCTCAAAATATTAATGACCAACCTCGTGGAGCCAAGCCAGGAT
AGGCCTATTTAATGTGCCATTCCATCATGTTCGTTTGCTTCCACCACCAC
CGAGCCTCGAAGTTTGTTTGCTACAACATTCTCCCAAGGTTTGTTTGCTT
CAACCTTCACCGAACCTAAAGCCAATCGGATTAATTCAATATTCCGATAT
CTTTATTCATCTCAGCACTTACTCTCGTTCATAACTCCACACTTAACTTT
TTGAGTCTTCCCTCTTTCCTACGTTAGACCGGTGATTTGGTTTCTTAACC
TTATCAACCATGAAGGAATACCCGGTTTCTCGCAAGCCCCGCATGGGAAA
GAAATCCAAAGGCCCGGTTGGTACTGGGATTTCTACCCATAAAAGATCTC
CCTCCATACCACCCTTACAATGGGGGTCTCGGATGTCGATGAGCCCAAAT
ACGAGGTTGCCGTGAGGTTTGACGACCTACAAGGGGATCTATATAGTCCT
TTCTATTCCGTCAAGAGATTTGAAGATCTTGGACTGCAATTCCAAGGATC
TTCTTGAGGGCATTTATTTCATGAACTTTAAGAAGCCGTCCATGATCCA

Sequences in the Contig:

SY0AAB9YD03FM1