Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB9YB21FM1
Length(NT) : 579
Best Gene Model Blast : Link to GSTUMT00009859001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein DEHA0F06556g
Accession: ref|XP_460621.1| Score: 533 E_value: 7e-53
KEGG Definition: hypothetical protein [EC:2.6.1.13]; K00819 ornithine--oxo-acid transaminase
Accession: dha:DEHA0F06556g Score: 533 E_value: 3e-53
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG1402 Score: 542 E_value: 2e-56
PFAM Definition: Aminotran_3, Aminotransferase class-III..
Pfam Number: pfam00202 Score: 270 E_value: 6e-25
Swissprot: Q92413|OAT_EMENI
Gene Ontology:
GO:0004587 = Molecular function: ornithine-oxo-acid transaminase activity

Sequence:
>SY0AAB9YB21FM1
TTGGTCTTTCTCCCCCAATCCTTACCGCTCCACCACCGCCACCTCCTCCT
TGTCCCGCATCACGGTACTTCACATCCCTTATCTGGTTCAGCATCCATCC
TAAACTCAATTGTCCCCAAAGTCATGTCTCCTGCTGCCATTGCTACTGCC
GGGGCTGCCGCCGCGCCGGCTTCAGAATCCGATGTCCCTATCCATGCTCC
CTCTTCTGAATTGGCAATGAAGTATGAGCACGAGTATGCGGCTCACAACT
ATCATCCATTGCCCATTGTCTTCTCGAAGGCTCTCGGTGTTCATGTTTGG
GATCCCGAGGGCAAACAATACCTTGACTTCTTGAGTGCCTATTCCGCCGT
TAACCAGGGTCATTGTCATCCCAAAATTGTTGGTGCTTTAATCACCCAAG
CCCAGCGTTTGTGTCTCTCCTCGAGAGCCTTCATTAATGATGTACTCCCA
ATGTTTTCGAAGTTTGTTACGGAGTACTTCGGTTACGACATGGTTCTTCC
TATGAACACTGGTGTCGAAGCTGTTGAAACTAGTCTTAAACTTGCTCGCA
AGTGGGGTTATCTAAAGAAGGGTATTCCT

Sequences in the Contig:

SY0AAB9YB21FM1