Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB9YB20FM1
Length(NT) : 626
Best Gene Model Blast : Link to GSTUMT00008022001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_08680
Accession: ref|XP_001552202.1| Score: 404 E_value: 7e-38
KEGG Definition: hypothetical protein
Accession: ncr:NCU06633.1 Score: 400 E_value: 1e-37
KOG Definition: No Hit Found
PFAM Definition: DUF6, Integral membrane protein DUF6. This family includes many hypothetical membrane proteins of unknown function. Many of the proteins contain two copies of the aligned region..
Pfam Number: pfam00892 Score: 113 E_value: 1e-06

Sequence:
>SY0AAB9YB20FM1
TTGGCAGATATTAACCATCAAACCTCCCGAGTTACGATATCGTATACTAT
AATACTGTACAAGACCTCGGCACAACCGAGTCGGAACCCTCACCAGTCTC
GCATTTCGCACAAACCTTAGACAAATCCCCTCCCCAAACAATGTCCTGGC
TCCATCTAGCAGTCGGCAGTGGCATAGCAGCAGCATTCAATGGGCTCTTC
GCAAAACTCACAACTACAGTCCTAACAACCAGCCTCTCCTCCTCAATCGC
CCGCCTATTCTCCCTACCGGACGACTCCAAAGCTGTCGAATTTGTTGTTC
GAGGGATATTTTTTGGGCTGAATTTATTGTTCAACGCAATCATGTGGGGA
CTCTTCACCGCAGCACTAGCAAAAGGACCCACAGCAACGAAAGTTAGTAT
AGTCAATACTTCTGCGAACTTTATGACAACAGCACTTCTCGGCTGGGCAG
TATTCACTGAATCCCTTCCGCCAACATGGTGGTTAGGCGCTGGCCTGCTC
GTTGTCGGAAACGTGATAATCGGCCGGCGAGATGAGGAAGACAAGAAGGA
CGGTGCATATCGAGCCGTTGCCACCGACGAGGGAGAACTAAGGGCAAGGG
GAGGGAGTGCGGAAAGTGAGTCTGAT

Sequences in the Contig:

SY0AAB9YB20FM1