Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB9YB09FM1
Length(NT) : 618
Best Gene Model Blast : Link to GSTUMT00011310001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001264509.1| Score: 259 E_value: 5e-21
KEGG Definition: TMEM1 family protein, putative
Accession: afm:AFUA_1G12540 Score: 256 E_value: 5e-21
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB9YB09FM1
TTGGCACAGCCTCTGGCATTGACAATTGAATATAGAAGTCTTGATGAAGA
GGTCCAAGACTCAGTTGTGGCGGCCTTTAGTTCTCAACTGGAAGAGGCTG
GACTAGACCTTTATTCTCGTTTGCTAGTACCCATACTGATTACTAGACTA
CGCCATAGAACAGCCCACGACTTGGAAGCTGCGGGACTGCTCAATGAAGT
AAAGTTAGGCAAATATGACAATTATAACTGGGATGAAGCTCTAGAGTCAA
TTAGCCCCGCCAACGGCGCACGAGAAAAAGCCGAAGCCTGGCTTAGAGAA
TTCTACGAGAAAAACTCTATAATAAAACTCGACCCCGAAACCCCTCCCGA
AAACCTCGTCCTAACCACGCGCTCGATAATAATCCCTGTCGATGTCCCCC
AACTACAGGTAATCCATACAGTAGACATCCACATCCTCTCCGACACCAAC
TCCACCACCCTCTCCTCTCCATACGCACCACCAATGGTAACCGTCGGACA
ACCCATTCCCGCAGAATTAATAATCCGCCACTCCCGTAGCTGGAACTCCC
TGGATGTCAAAAATGGCGAAGTTGAAATCGGCAACGACGATGAGCTAGAA
TTCTTTTATGAGATCCAG

Sequences in the Contig:

SY0AAB9YB09FM1