Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB9YB08FM1
Length(NT) : 686
Best Gene Model Blast : Link to GSTUMT00009036001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: G6PI_ASPOR Glucose-6-phosphate isomerase (GPI) (Phosphoglucose isomerase) (PGI) (Phosphohexose isomerase) (PHI)
Accession: ref|XP_663641.1| Score: 739 E_value: 1e-76
KEGG Definition: glucose-6-phosphate isomerase [EC:5.3.1.9]; K01810 glucose-6-phosphate isomerase
Accession: ani:AN6037.2 Score: 739 E_value: 6e-77
KOG Definition:
Classification: [Carbohydrate transport and metabolism].
Kog Number: KOG2446 Score: 651 E_value: 6e-69
PFAM Definition: PGI, Phosphoglucose isomerase. Phosphoglucose isomerase catalyses the interconversion of glucose-6-phosphate and fructose-6-phosphate..
Pfam Number: pfam00342 Score: 466 E_value: 1e-47
Swissprot: Q9HGZ2|G6PI_ASPOR

Sequence:
>SY0AAB9YB08FM1
TTGGACCATCGACAACAGTTGCTCTCTCTAAGCGGAGAAAGACAATCGGT
GTTCGGAATCATCGCTATATCCTTTTGTGTAGGGAAGGTTTCTATTTTAA
CAAATCAAGCCATGCCTTTCAGTCTTGCTTCAGAATTGCCTGCCTGGAAA
ACTCTCCAGGATCACTATCATACTGTCAAGACATTGCACTTGTCGGATTT
GTTTGCTCAGGATCCCAAGAGGGCCGAGAAGTTCTCTCGTTCGTTCCTTA
ATGATGCCGACGGAAACGAGATTTACTTTGACTTCAGCAAGAACTTTCTC
ACGGAAGAGACCCTTGGGCTCCTGATCAAACTAGCCAAGGAGGCTGATGT
CGAAGGGCTTCGTGACAGAATGTTCAAGGGTGAGAAGGTCAACTTTACTG
AAGAGAGAGCTGTATACCATATGGCTTTACGCAATGTTTCGAATAAGACT
ATGGAAGTCGATGGGAAGAGCGTTGTTGAGGACGTTAACTCCGTAATAGA
ACATATGAAGGAGTTCTCGGAGCAGGTTCGCAGCGGTGAGTGGAAGGGGC
ATACTGGTCAGCGCATCAAGAGCATTGTGAATATTGGGATTGGTGGCTCC
GATCTTGGGCCGGTCATGGTTACGGAGACTCTAAAACCTTACGGACACCC
TGACTTGACCTTGCATTTTGTGTCAAATATTGATGG

Sequences in the Contig:

SY0AAB9YB08FM1