Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB9YA21FM1
Length(NT) : 616
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: Herpes_BLLF1, Herpes virus major outer envelope glycoprotein (BLLF1). This family consists of the BLLF1 viral late glycoprotein, also termed gp350/220. It is the most abundantly expressed glycoprotein in the viral envelope of the Herpesviruses and is the major antigen responsible for stimulating the production of neutralising antibodies in vivo..
Pfam Number: pfam05109 Score: 126 E_value: 4e-08

Sequence:
>SY0AAB9YA21FM1
TTGGGGATTGTCCACACCTGAGGCTACACCTTTGAGGTATACTGCTCCCC
AGCGACAGCCGCAGGTGTTAAACGAAACGAATAGTGCAGATAGTAATGAT
CCGATACCACCAATAATCACTCCCGCAAGACGGTCTGGGGGGGCCCAAAT
TCCGCCCACCCCTCCAACGACTCCGGCGAGGAGGAAGAGCCTGCTATACT
CGAGGGAGAACTCGAGAGAAAGTGTTTCAACCACTGGCACAAGCACTAGT
AGTAAATACATCGCTCCAACCGGAACGATAACTCCTCCCAGTGAAGCGGC
ATCAGCCATCGAAGCTGAAGAAACAAAGGTTGAGGAAAGAAAATTTGAGG
AAGAGAAGCCCAAGACTGAAGCGCCGAAGACCGAGGAGCCGGACAAGGTT
GCCGACTCCGAGAACGGACACGGACATGGGCATGGTGGGCATGATTGCCC
ATTCCTCCGCCGATCGGCTAGTCCTCGGCCATCGAGTTCGCACTCGTATT
CATACTCCTACAGCGTCTCCAGCACCCCAGAGCCCGTAAGACCGCACTCC
TATAGCTCCCCAGAAGTCCCGCGCTTTACAACCCACTTTCACAGCGGGCC
GAGCACCCCCGCACCG

Sequences in the Contig:

SY0AAB9YA21FM1