Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB8YM23FM1
Length(NT) : 442
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein
Accession: emb|CAN70790.1| Score: 230 E_value: 6e-21
KEGG Definition: predicted protein
Accession: olu:OSTLU_42581 Score: 125 E_value: 2e-13
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB8YM23FM1
TTGGCCAACTTTTTTTGTACAAAGTTGTCCCCTCAGTATTCAATTGTCAG
AGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGC
CAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGA
TCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGG
CGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTCTT
TGGGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTGAC
GGAAGGACGGAAAGGGACGCTCTTTAACATTTTTTCTCTTTCCTTATATT
TTTCCTTTCCTTTGTAAAAGCCTTTTTATTGGCAGTTGGATATAGCAACC
GGTCCTGTACATGTGCTTTTTGTCCTTCGGACGATAATCATT

Sequences in the Contig:

SY0AAB8YM23FM1