Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB8YM21FM1
Length(NT) : 704
Best Gene Model Blast : Link to GSTUMT00003465001 E-value : 1e-109
Numbers of ESTs : 1

Blast Results:

Nr Definition: beta tubulin
Accession: ref|XP_001594844.1| Score: 914 E_value: 7e-97
KEGG Definition: beta tubulin; K07375 tubulin beta
Accession: aor:AO090038000317 Score: 907 E_value: 2e-96
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG1375 Score: 536 E_value: 1e-55
PFAM Definition: Tubulin, Tubulin/FtsZ family, GTPase domain. This family includes the tubulin alpha, beta and gamma chains, as well as the bacterial FtsZ family of proteins. Members of this family are involved in polymer formation. FtsZ is the polymer-forming protein of bacterial cell division. It is part of a ring in the middle of the dividing cell that is required for constriction of cell membrane and cell envelope to yield two daughter cells. FtsZ and tubulin are GTPases. FtsZ can polymerise into tubes, sheets, and rings in vitro and is ubiquitous in eubacteria and archaea. Tubulin is the major component of microtubules..
Pfam Number: pfam00091 Score: 549 E_value: 4e-57
Swissprot: P16040|TBB_ERYGR

Sequence:
>SY0AAB8YM21FM1
TTGGTCTATCTATAAATCACAATTTTACGTTTATTCACCCGATTTACGAA
TCAATTACACCTTCCTCTATAGTCGTAAGTTTACCTTGTCTACCCCTCCG
GGAGACGCGTTTTGGAATCAGAATGCGCGAAATCGTTCACTTGCAAACTG
GTCAGTGCGGTAACCAGATTGGTGCCGCTTTCTGGCAAACAATCAGTGGA
GAACATGGACTTGATGGGTCGGGTGTCTACAACGGAACGAGTGACCTGCA
GCTCGAGCGTATGAATGTCTACTTCAATGAGGTTGGTGCTTCCGGCAACA
AATACGTTCCCCGTGCTGTGTTGGTCGACTTGGAACCGGGTACCATGGAC
GCTGTTCGATCCGGTCCCTTCGGAAACCTCTTCAGGCCGGATAACTTCGT
CTTTGGACAATCCGGTGCTGGTAACAACTGGGCCAAGGGCCATTATACCG
AGGGTGCTGAACTTGTCGACCAGGTGTTGGATGTCGTTCGTCGTGAGGCC
GAAGGCTGCGACTGTCTGCAAGGTTTCCAGATTACTCACTCGCTTGGTGG
TGGTACTGGCGCTGGTATGGGAACGCTCTTGATCTCCAAGATCCGTGAAG
AGTTCCCCGACAGAATGATGGCCACTTTCTCCGTTGTTCCTTCACCTAAG
GTCTCAGACACCGTTGTTGAACCATACAACGCCACCTTATCGGTACACCA
GCTT

Sequences in the Contig:

SY0AAB8YM21FM1