Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB8YK05FM1
Length(NT) : 659
Best Gene Model Blast : Link to GSTUMT00006599001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE66048.1| Score: 479 E_value: 2e-46
KEGG Definition: ankyrin repeat
Accession: aor:AO090010000141 Score: 479 E_value: 8e-47
KOG Definition:
Classification: [Cell wall/membrane/envelope biogenesis].
Kog Number: KOG4177 Score: 259 E_value: 2e-23
PFAM Definition: No Hit Found
Swissprot: Q9ERK0|RIPK4_MOUSE

Sequence:
>SY0AAB8YK05FM1
TTGGATATGCGGCCTGGAAGGGAGAGGAAACTATAGTCAAGCTGCTCTTA
GACTGCAAGAATGTTAATCCCGATTTGCCGGACAGCTATGGTCGAACGCC
TCTATCATATGCTGTCGAGCAGGGGGCACAAGGTGTCGTGAAGCTACTTC
TTGAACGCGGGGATGTTAATCCCGATTTACCGGCTACCAATGGCCGAACA
CCCCTATCATATGCAGCCTGGAGGAGAGACGAAGCTATAGCGAAACTACT
CCTGGACCGCAAGGATGTCAATCCCAATTTACCGGATAATGAGGGTCGAA
CGCTCTTATCATACGCTGCTGAGCAGGGGGCTCAAGGTGTCGTGAAGCTA
CTTCTTGAGCGCGAGGATGTCAATCCAGATTTACCGGCTAATAATCGCTC
TGCGCCTATATCATATGCGGCCTGGAAAGGAGAGGAGACTATAGTGAAGC
TGCTCCTCGACTGTAAGAGTGTTAATCCCGATTTGCCGGATAGCCATTGT
CGAACGCCTCTATCATATGCTGTCGAGCAGGGGGCACAAGGTGTCGTGAA
GCTACTTCTTGAACGCGGGGATGTGAATCCTAATTTACCGGATAGTAATG
GTCGAACACCCTTATCATATGCTGCACGGCATGGGTAGCAGTGTGTACTA
AATCTATTT

Sequences in the Contig:

SY0AAB8YK05FM1