Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB8YG03FM1
Length(NT) : 229
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: unnamed protein product
Accession: ref|XP_453843.1| Score: 176 E_value: 1e-11
KEGG Definition: unnamed protein product
Accession: kla:KLLA0D17710g Score: 176 E_value: 4e-12
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB8YG03FM1
TTGGGGTGCGTTCCCGACGACCCTTGAAAATCCGGGGGAAGGAATAGTTT
TCGCGCCAGGTCGTACTCATAACCGCAGCAGGTCTCCAAGGTGAAAAGCC
TCTAGTTGATGGAACAATGTAGATAAGGGGACCTGGCAAATAGGGGTGGC
AATGGGAAGGGTTGGAATGTCTATTGTTTCAAGTTTCTGTTTTCTACTCT
TTTTTACTTCACAAAGTTCTGATTTTTCG

Sequences in the Contig:

SY0AAB8YG03FM1