Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB8YE02FM1
Length(NT) : 652
Best Gene Model Blast : Link to GSTUMT00008332001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001212453.1| Score: 370 E_value: 7e-34
KEGG Definition: hypothetical protein
Accession: ang:An02g10560 Score: 361 E_value: 4e-33
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0509 Score: 245 E_value: 6e-22
PFAM Definition: No Hit Found
Swissprot: P57078|RIPK4_HUMAN

Sequence:
>SY0AAB8YE02FM1
TTGGACCGGTACCAAAACCCGGTACCCAGCCCAACCGAAGTCATACTCAC
GTTACCCGATAACCCTTACCGCTTCTTATAAGGCTTGCAGATGGCGGAGA
GAGGCAACACACCACAAACGATAGATCTCGGCTCCCCACGGAGGAGGCGT
GTCGACGTCAACATTCCAGACAGAGACGGCCAAACGGCACTCTTGTGGGC
AGCGAAGCAAGGGCACGAGGAGGTTGTGAAGCTAATACTGAGTCGGGGGG
ATATTGCTACCGGTGCAGCAGACTACCACGACCTAACTCCACTGGATTGG
GCTGCTGCGTACGGTCATGAGGGGGTTGCGAGGCTATTATTGGACCGGAA
AGATGTCGACCCCGAGAGGCAGGGGCGGTGGGGCAAAACACCACTCTTGT
TGGCCGCCGACAATGGGAATGAGGGGGTGGTTGGGCTGCTACTGGAATGC
AAGGATGTTAACCCCGAAAGGCAAGACCTGCGGGGTCAAAAACCGCTCTT
GCTAGCCGCAAACAAGGGACATACGGGGGTGATGCGGCAGCTACTGGAGC
GGAAAGATGTCGACCCCAACGGGCGAGGCCCATACGGCACAACGCCACTC
TCCGTGGCTGCAATGTGGGGAAACGAGGAAGTGGTTCGGTTACTACTAGA
GC

Sequences in the Contig:

SY0AAB8YE02FM1