Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB8YC13FM1
Length(NT) : 645
Best Gene Model Blast : Link to GSTUMT00007133001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_07910
Accession: ref|XP_001591284.1| Score: 377 E_value: 1e-34
KEGG Definition: hypothetical protein
Accession: afm:AFUA_1G06500 Score: 358 E_value: 8e-33
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB8YC13FM1
TTGGAGTTGATGAGACCGCTCCTCTCCCGAATAATACCACTCCTCCTCCT
CTCTATCGTAATCCTAAGCATCCTCTTCGCTACCGTCTACCTCCCACAAG
TTGCGCTACTCACTCTTTTCCACGGACCCCTAGCATGGATAAATGCAGCG
TTCATGGCCCTAACCGAAGCCGCGACGCTGATAACCTTTGTCGCAGAGAA
CTTCATGACAGAAGGCCAGATCGTGGATACCTTTGACGCTGTGCTTATAC
ACGCGGCTTAGAAGTCTAACGATGCAGAGTTTAGAGAGCGTATTTATGCC
CTTGTACACACTGCTAGGGATATTCATCTCGAGAGGGAGGGGGTCATAGC
GAAGTTGGGGGAGCATAGGAAGAGTCCTTATCTGAGGTTTTCGTGTAGGC
TTACGATGGAATTTATTTGCGAGCTCCCGTTGAATTTCATTCCGTTGGTT
GGAACTCCGCTGTTTTTGATGTTACAGGGCTACCATCTCGGCCCACTATC
GCATTACCGATACATTCAACTCAACGACTTACATAAAAAAGAAAAGAAGA
AATTTATTGACCTTAATAGGTGGAGATACTGGCTATTTGGGCTGCCGCAC
GTCGGTCTGCAAGTTGTACCTGTATTAAGTATCCTATTCCTGTTC

Sequences in the Contig:

SY0AAB8YC13FM1