Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB8YC07FM1
Length(NT) : 709
Best Gene Model Blast : Link to GSTUMT00010371001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: C6 transcription factor, putative
Accession: ref|XP_001268587.1| Score: 153 E_value: 1e-08
KEGG Definition: hypothetical protein
Accession: ang:An01g10060 Score: 151 E_value: 1e-08
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB8YC07FM1
ATTGGCACAGCCGGCACCAATGGCCCCGAATTCACATCTTTCGCCCGGGG
GAAGCCAGAAGACTTAGAGGCTCGGATGAATAGACTTGCCGAGATCGTCG
ATAGGTGGTACAAGGATGCGTATGGTCAAAGGATCATACCGCCTGTGGCG
AGACAGCAGGCTGTCGATGCTGTCGGAGTTAACAACTCTGATGCGAAGAG
CTCATTTGAGGGAACTTTGGGACAAATTCCGACACGTGAACGCCTCGTTC
CCCAGGAACAGGGTGTCTCGGACAACATGAGAAAACTCACCTACTCGATC
AGCGGTATCAGCTGTGCCCCAGCCCATTCAATTCCCTGTTCCTCCGTATC
CTCATCCCATTCACCACGTTCGCGGGACACTATCACAACACCTTCTAGTA
GTGCCGACGGGTATTCCCAGCAAGTTTGCACCCTTGAAGGTAAAAATGGA
GCTACACATCCTCCCAAGCAAATGGCGAGGGGACAGCTTGCTATGAAGTT
ACTAGACGAAGAAATTGAAGCAGCAAGAGGGAAAGGCACATGTGACGATA
TAGGTGATCTAGGATTAGGCCATTTGAGTATCCAGGGTCGTGGAAGGAGT
CGATATGTTGGAAGCAGTTTTTGGGCCTCCATAAGCCATGAGATCGCCGA
GCTTAATGACGTCTTACGTGCCAACGAACCGCCCGATACGAGATGCTCTG
CTGGTCCTC

Sequences in the Contig:

SY0AAB8YC07FM1