Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB7YO13FM1
Length(NT) : 428
Best Gene Model Blast : Link to GSTUMT00004502001 E-value : 3e-81
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_08336
Accession: ref|XP_001798656.1| Score: 191 E_value: 2e-13
KEGG Definition: 50S ribosomal protein L13; K02871 large subunit ribosomal protein L13
Accession: afm:AFUA_2G10510 Score: 189 E_value: 1e-13
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG3203 Score: 135 E_value: 2e-09
PFAM Definition: No Hit Found
Swissprot: Q12487|RM23_YEAST
Gene Ontology:
GO:0005762 = Cellular component: mitochondrial large ribosomal subunit
GO:0003735 = Molecular function: structural constituent of ribosome
GO:0006412 = Biological process: translation

Sequence:
>SY0AAB7YO13FM1
TTGGAGCAAGTCTAGGCAAAGAAGTCGTGGGTGGGGGCTTCGTACTCGCA
TTGTGAGGAATCATGAGTGGTGGGGGGTTGTTTGGTTGCTGGTGACTGGG
CTAGCCACAGGAAGCCTCGATGCTTAATAATCCAACCAAAAGAAGTCTCG
CTAGTCAAATTCGGGATTCATTTTTCGGGGGAACCCAATCCCAGAAATAA
TCATCTCATCCCCCCCACTAAAGCAGCCCGACGACATCTGGAGCACCCCC
CGAGACAACAATGTCTACCAACATCGGAAGGACTTCCTTGGCCTACAGTC
GGTCATGGCATCTCGTCGATATGGGCCATGACCAGCGATCCTTCGGTCGT
ATTGCGACGTCAATCGCTACGACGCTCATGGGAAAGCATAAACCAACCTA
TGATCCAAGTAACACTTGGGGGGGGGGG

Sequences in the Contig:

SY0AAB7YO13FM1