Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB7YG23FM1
Length(NT) : 739
Best Gene Model Blast : Link to GSTUMT00010739001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_08695
Accession: ref|XP_001799004.1| Score: 381 E_value: 2e-43
KEGG Definition: hypothetical protein
Accession: ncr:NCU06540.1 Score: 370 E_value: 5e-41
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG4592 Score: 193 E_value: 7e-16
PFAM Definition: No Hit Found

Sequence:
>SY0AAB7YG23FM1
TTGGCATCCTGGGGGTGTGCCGCTACAACCGCAGAGAATACAGACAATGG
GGCAACCATTACATCCCTCACGGAATCAGTATGGGATGACAAATCATGTC
CCAACACCGCAGTTACAAAAAATGACTGAGGTGGAGAAAGCTCGATTTTT
GGAGGAAGAGAGTAAGCGTTTGAAGAGAAATCACAAGATCGCCCAGTTGA
TAAAAACTTTATCACTCGCATACAGCTCCAACATCTGGTATCTATAAATA
ATGCTGAGGATAATGCCAATGAGGACTTCTACTACATTGTTCATTCGGCA
ATTCGGGCACGAACAAACCCTCAACAACCCCTTAATCAATTTGCACAAAC
CTATCTTTTCCGTCAGAGTGCAAGAGGAAGGAATAGGCAACAGGACAACC
ACCTACAGCGTATGGAGCAACAAGTTCAGCGGGCTGTCGCTGCTGCAAAA
GCTCGTCCAAAAGCTAGTCAATTAGTACTAGAAGGTAGTCTGGGCAAAAT
CTCTTTTAGTAATGTTAAGACGCCGCGGCCTATGCTCAACATCAAGAAGT
CTGACTCCCCTGGTGGAGAGCCTATAAGAAGAACTCAACGTTCAACATTT
TCAAGCGCTGACAGAAAATCTTTGCTCAGAGCCATTGAGAATGTTTATGA
TGCACTGCTAGAGCTAGAGGTTCATGAACGTGAGAGGTCAAAGCTGCCAA
TCCTGATGCCAGATCAGCAGCCCCAGCAAGCTCATATCG

Sequences in the Contig:

SY0AAB7YG23FM1