Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB7YG03FM1
Length(NT) : 681
Best Gene Model Blast : Link to GSTUMT00011844001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: cytoskeleton assembly control protein Sla1, putative
Accession: ref|XP_001262001.1| Score: 179 E_value: 1e-11
KEGG Definition: hypothetical protein
Accession: ang:An16g08460 Score: 174 E_value: 2e-11
KOG Definition: No Hit Found
PFAM Definition: SHD1, SLA1 homology domain 1, SHD1. NPFXD peptides specifically interact with the SHD1 domain. NPFXD is a clathrin-facilitated endocytic targeting signal. NPFXD was originally discovered in the cytoplasmic domain of the furin-like protease Kex2p. Sla1 is thought to function as an endocytic adaptor..
Pfam Number: pfam03983 Score: 188 E_value: 2e-15
Swissprot: P32790|SLA1_YEAST
Gene Ontology:
GO:0005938 = Cellular component: cell cortex
GO:0005634 = Cellular component: nucleus
GO:0008092 = Molecular function: cytoskeletal protein binding
GO:0030674 = Molecular function: protein binding, bridging
GO:0043130 = Molecular function: ubiquitin binding
GO:0000147 = Biological process: actin cortical patch assembly
GO:0007015 = Biological process: actin filament organization
GO:0007121 = Biological process: bipolar cellular bud site selection
GO:0007047 = Biological process: cell wall organization and biogenesis
GO:0006897 = Biological process: endocytosis

Sequence:
>SY0AAB7YG03FM1
TTGGAAACGGAGAGGGAATAGAAGACAAGGAGATATCCCCAAAACTCAAT
TCCGAACCCGAATACGAACCCGACCCCGAGACCCATCTGGCAGAGCCTAA
CCCAAAGTCGCGAGAGCCCTCTCGGAAACCGCGCACCGCTATGGAATACA
GAATCTGGACCGACAAAAACGGTCAATACAGACAAGAGATGATACTCCTC
GGCTGCGAGAACGACCACGTACTCTTACTAAAGCGTGATGGCGTAAGACT
TAATATCCTTAAGTCAGACTTATCCCCTCAGGACCAAGAATTTGTTACCC
AAGCGATGGAACCGCCTATCACAACCTCTCTAAACGGACTCTCGCCAAAT
GATAACACATCGGTGATCCCATTGTACTCGTACTCCAATAAACCGAAGCC
GGACCCTAGTAAGATCCGGAGTTGGCTAGACATCACAGGCAGATACAGTG
TTGATGCGCAACTGGTGGGGTTCCGGAAGGGTAAGATTGTGTTGCATAAG
ACCGATGGTGTTAAGGTTGGGGTTATTCCCAATCAGATGGCTAAGGATGA
TTTGGCGTTTGCCGAGAAGGAACTTGGGATGGTGTTGACGGGGATTGCGA
AGGAGAGGAGAGGAAAGGCGATTGCTTGAATGATTATAGGGGCACACGAT
TATTATTCATTTGTCTGTTTATCTTCTCCCC

Sequences in the Contig:

SY0AAB7YG03FM1