Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB7YF03FM1
Length(NT) : 680
Best Gene Model Blast : Link to GSTUMT00007332001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein An04g05110
Accession: ref|XP_001401875.1| Score: 398 E_value: 4e-37
KEGG Definition: hypothetical protein
Accession: ang:An04g05110 Score: 398 E_value: 2e-37
KOG Definition: No Hit Found
PFAM Definition: Suc_Fer-like, Sucrase/ferredoxin-like. This family contains a number of bacterial and eukaryotic proteins approximately 400 residues long that resemble ferredoxin and appear to have sucrolytic activity..
Pfam Number: pfam06999 Score: 271 E_value: 7e-25
Swissprot: P38281|APD1_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0005634 = Cellular component: nucleus
GO:0042802 = Molecular function: identical protein binding

Sequence:
>SY0AAB7YF03FM1
TTGGCACTGTTATTGAAAATGTCACCCCGAACGAGACTCCGGAGCTCATT
CGACGATTCATCAATACTGGTCCGACAACTTCCACTCCTCTAGACCCTCC
TGCATTGACACCCGTGAGCCCTGCTTCTTCGTCTACTCCTTCGACCCCAC
TGGGCCGTGCCCTTTCATTCCCCTTCAGAACCGAACCTAGAAGTGAAAAG
GGGCCCGATCCAGCGGAAGCCAAAGCCCCCTCCCCCACTGCTGCACCCTC
CTCCGAAGATACCAGCGCGCCTACCCCAGAAAAAGAAACGGGAGTGGAGA
ACCCCACTGCAAAACCCTCCCTACTCGACGACTCCTTCATCACCCTCTCT
CTTGAGCCCTCCTCGACTCTAAAATCTCACCCCTTCCCACACTCCTACCT
AATTCTCATCTGCTCGCACCGTCGCCGCGACGCACGCTGCGGCATTTCTG
CCCCCATCCTGCGCAAAGAATTCGAAAAGCATCTGCGCCCGCTCAACCTT
TGGCGCGACCTCACCGACACCCGCGACGGCGGAGCCAAGGTGCTCTTCAT
CAACCACGTCGGCGGGCACAAGTACTCTGCCAACGTCATCATTTACAGGA
AGGAGGACGGGCAAGGGATTTGGCTGGCGAGGGTCGCACCGAAGCATATT
GAAGGGATCGTCAGGTTTACCATTTTGCAG

Sequences in the Contig:

SY0AAB7YF03FM1