Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB6YN21FM1
Length(NT) : 506
Best Gene Model Blast : Link to GSTUMT00003032001 E-value : 1e-176
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein MGG_04172
Accession: ref|XP_361698.1| Score: 130 E_value: 2e-06
KEGG Definition: hypothetical protein
Accession: mgr:MGG_04172 Score: 130 E_value: 1e-06
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB6YN21FM1
TTGGCGTAAGGTGAATGATAATTTCGCTCCCCGGCTGGAAAACTAGATTT
GCAAGGAGGAGCTGTTCTAGTGTTATGGATGCTTAAATACGAGACGATAC
CTTCGAACTCCTCTTCCTTTTTTCTTTTCTACCACTAGCTCCCGTTTCCT
GCTTCCTCTGGTGTGCCCCCTCACGTTCTGTCGTTACAAATTAATCATGA
ATACACGAAATCTCTTCCTTCTCGCCCTTGCCGGGTTCACCAGTGGGGTC
CTCTCCGAAAACATAGTGATAGATGACTTCAAGAAACAGGGCACCAACAA
TTTAAATGTCTACCACGGCTGTGACGAGGGCGGTGGGATCTCATGTTCGT
GGGGCGGCGATGGCCTAACTATCAGATCCTCAGATGTCGACTACTCCTAC
TACAGTCAATTCACCAGCCAACGCGGCGATGGCGGTTGCCAGGATATCTC
ATCCTGGGAGCGTCGGTTCGTACACATCAAGTTCTCAGGAAGCCCAGATT
TCTCCG

Sequences in the Contig:

SY0AAB6YN21FM1