Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB6YN04FM1
Length(NT) : 704
Best Gene Model Blast : Link to GSTUMT00007020001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein FG02870.1
Accession: ref|XP_383046.1| Score: 724 E_value: 8e-83
KEGG Definition: hypothetical protein
Accession: fgr:FG02870.1 Score: 724 E_value: 4e-83
KOG Definition:
Classification: [Secondary metabolites biosynthesis, transport and catabolism].
Kog Number: KOG0065 Score: 694 E_value: 6e-74
PFAM Definition: ABC_tran, ABC transporter. ABC transporters for a large family of proteins responsible for translocation of a variety of compounds across biological membranes. ABC transporters are the largest family of proteins in many completely sequenced bacteria. ABC transporters are composed of two copies of this domain and two copies of a transmembrane domain pfam00664. These four domains may belong to a single polypeptide, or belong in different polypeptide chains..
Pfam Number: pfam00005 Score: 147 E_value: 2e-10
Swissprot: P41820|BFR1_SCHPO
Gene Ontology:
GO:0005886 = Cellular component: plasma membrane

Sequence:
>SY0AAB6YN04FM1
TTGGGAAGTTCCTCTCGAAGAGAAGTATGAATATGTCGAGACTATCATCA
AGCTATTGGAGATGGAAGACATTGCAGGCGCTACCGTTGGCAGCCAAGGG
AATGGTTGAATCAAGAGCAGAGGAAGCGCTTGACCATCGGTGTTGAATTG
GCGAGTAAGCCAGAGTTGCTAATATTCCTTGACGAGCCCACATCTGGACT
GGATTCTAATGCAGCTTTCAACGTCATCCGCTTCCTCCGCAAACTCGCCG
GCTCCGGTCAAGCTATTCTTTGCACCATCCATCAACCCAGCGCCGTCCTC
TTCGAACACTTTGACGACCTCATCCTCCTAAAGAGCGGCGGCCGGGTAGT
CTACCACGGGCCACTCGGCAACGATTCGCATACGATGATAAAATACTTTG
AATCAAACGGCGCCCCACGCTGTCCCAAGGACAAGAACCCAGCGGAGTAC
ATGCTTGAGGCGATCGGCGCCGGAGACCCCAACCGCAAGGAAAAAGACTG
GGCCGAAGTCTGGTCAAACTCGGCAAACCACACCGCGCGTATCGAAGAGA
TCAACCAACTGATAGCCTCCCGCCTCTCCCAGGCTTCGGAGAACCAAATA
GCTGACAACCGCGAATTCGCTATGCCCTGGCACACCCAAGTCCTCGCGGT
GGTGCAGCGGACATTTGTAAACTACTGGCGCACGCCCCAATACACGATCG
GCAA

Sequences in the Contig:

SY0AAB6YN04FM1