Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB6YJ10FM1
Length(NT) : 485
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CIMG_02484
Accession: ref|XP_001248713.1| Score: 176 E_value: 2e-17
KEGG Definition: hypothetical protein
Accession: ani:AN5136.2 Score: 164 E_value: 5e-16
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q04406|EMI1_YEAST
Gene Ontology:
GO:0045944 = Biological process: positive regulation of transcription from RNA polymerase II promoter
GO:0030437 = Biological process: ascospore formation

Sequence:
>SY0AAB6YJ10FM1
GGGCCTCCGTGGAACCTCAGACCCAGGGAAGGACCCCCGCGAAGCAGCGG
CAGACGCAGAACTATCGGAACTACTATCAAACCTCGAAGCGGAAGCCGCT
GCCATTGCCCAGCGAAAGCCCACCACCGCAAGCAAAGGGGAAGAGGACGA
AAGAGAAGCAACAGCCTTCCCAACCGAAATGTCATGCATAACAGCCTTCG
ACGAGATGTACTACTGCTACTCCCTTGGCGGCCAATTCCTAAACGGTACG
GCGAACTTAAATCTTGCAGTGAGAAAGCGGCCGATTGGCGATTCTGCATG
CGCACGCGCAGTTATGGGCCTATTGCGAGGAAGGCTATGATCATGGCGAG
ATTTAAGGAGAAGGCGGGGCGGTATAAGGTTGGTAGGAGTAGTGAGGATG
TGTGGGAGGTTAGGAGAGTGCCAGTTGTTGCAGCTTTTAGGGGGGAAGTG
AGGGAGTAGATTGGGGGGGGGGTATGATATGGACC

Sequences in the Contig:

SY0AAB6YJ10FM1