Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB6YB23FM1
Length(NT) : 272
Best Gene Model Blast : Link to GSTUMT00002981001 E-value : 3e-68
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein NCU00102
Accession: ref|XP_957226.1| Score: 130 E_value: 2e-06
KEGG Definition: hypothetical protein
Accession: ncr:NCU00102.1 Score: 130 E_value: 9e-07
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB6YB23FM1
TTGGGTTTAAGATGAACGTCTAGACAAATGGGAACAACAGCTGAGGAGGA
ATATGCGAGCTGGGTTGAGAAATATGGCGAGGAGGGCGCCAGGATAATAG
AGAAAGCTGTAGATGCGAACTTGAGGGACTATGAATACTTGAAGCAGTTT
AAGATGAACGTCTAGACAAATGGGAACAACAGGGCTTGATCGGTTATAGT
TTGTTTTATTGGATTCAATGAACTGTATGCGGTAGTTATACCCTTGATAC
TACCGGCACGATACAATGCCGT

Sequences in the Contig:

SY0AAB6YB23FM1