Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB6YA22FM1
Length(NT) : 682
Best Gene Model Blast : Link to GSTUMT00008306001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001539038.1| Score: 781 E_value: 2e-90
KEGG Definition: hypothetical protein
Accession: ang:An02g08630 Score: 757 E_value: 9e-89
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG0592 Score: 650 E_value: 6e-69
PFAM Definition: Pkinase, Protein kinase domain..
Pfam Number: pfam00069 Score: 382 E_value: 9e-38
Swissprot: O55173|PDPK1_RAT

Sequence:
>SY0AAB6YA22FM1
TTGGAGAATTACTTGGTTTTCTTAAGAGGATGACCACTTTCGATGAAGAA
TGTACCCGGTATTACTCGGCGCAAATTTTGGACAATTGAGTATATGCACT
CCAAAGGAGTCATACATCGTGATCTGAAGCCGGAGAACGTTTTACTGGAC
GACCAGATGCGGGTCAAAATTACAGACTTTGGTACCGCCAAGATTCTAGA
CCCACCAAAGAAACCCCCACAGAACGGGGATGGACCAAGCGGGATGTCAT
ATCCTGGGGATCCCACAGAGGAGAGTGATTCAAAGGCGAACTCATTTGTG
GGCACAGCCGAATATGTTTCTCCAGAGCTCTTGACAGATAAAGCGGCGTG
CAAAGCTTCAGATTTGTGGGCTTTTGGATGTATCGTTTTCCAGCTGCTCT
CCGGAAGACCTCCGTTCAAGGCGGCAAATGAATATCAAACATTTCAGAAG
ATTGTCGATTTGGAGTATGAATTTCCACAGGGGTTTCCTCCGGTAGCTAG
AGATCTTGTGGAGAGGTTACTTGTTCTCGATCCCGCCAAGCGGCTCAATA
TTGAGCATATCAAGAATCATGAGTTTTTTGATGGCATTGTGTGGGGCCGA
AAACTCTGGAAGATCAAGGCGCCTAGATTGAAGCCATACGTGCCACCTCC
AGCCGAGGAGAGGATCATCAAGTTGAATGATA

Sequences in the Contig:

SY0AAB6YA22FM1