Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB6YA08FM1
Length(NT) : 650
Best Gene Model Blast : Link to GSTUMT00006718001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: glutathione S-transferase, putative
Accession: ref|XP_001265610.1| Score: 317 E_value: 4e-48
KEGG Definition: hypothetical protein
Accession: ang:An07g01100 Score: 335 E_value: 8e-48
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0406 Score: 163 E_value: 2e-12
PFAM Definition: GST_N, Glutathione S-transferase, N-terminal domain. Function: conjugation of reduced glutathione to a variety of targets. Also included in the alignment, but are not GSTs: * S-crystallins from squid. Similarity to GST previously noted. * Eukaryotic elongation factors 1-gamma. Not known to have GST activity; similarity not previously recognised. * HSP26 family of stress-related proteins. including auxin-regulated proteins in plants and stringent starvation proteins in E. coli. Not known to have GST activity. Similarity not previously recognised. The glutathione molecule binds in a cleft between N and C-terminal domains - the catalytically important residues are proposed to reside in the N-terminal domain..
Pfam Number: pfam02798 Score: 123 E_value: 8e-08
Swissprot: Q03425|GSTZ2_DIACA
Gene Ontology:
GO:0004364 = Molecular function: glutathione transferase activity

Sequence:
>SY0AAB6YA08FM1
TTGGCACCAAGATTACAAAAAAAAAGATAAAAATGTCCATCACGCTCTAC
ACAAGCCGTATCTGCCCCTGGGCTCACCGTGCACACATAGCATTGGCAGA
GCTCGGGCTAGACTTCAAAGAGGTCACGATTGATCTGATGAAGCCGAGGG
AGCCATGGTACCTTGAGATCAACCCCAGGGGGCTAGTCCCGTCGCTCAAA
TACAATGACGAAATAATCACCGAATCCTCTATTGTCGCTACTTTCCTCGC
GGAATTGAAAGAGAACCACTTAGTCCCCTTCCCGGGCACTCCGGAGGCGG
GCCAAAATCAACTTCTTCGTGGACACCTACTTTACCAAAGCTCAACCGCT
AATCCAATCCGCCCTCGTCACAACCGACATGGCGGCAAAGGCCCGGTACG
CAAACGAGTGCGTCGACGTTATCGAGAAGCAATTGGCGCCGTTGCTGGCG
GACGCTAAGCCCTTCTTTGGCGGGAGCTCCAGGCTCACGCTTGCGGAGGT
GCTTACTGCTTCGTTCGTCGTTAGATTGTATACATACGCGAAGCCTGGGG
TTGACTTTTTCCCCCAGGAGGCGATAGAGATGATCAGGAAGATTGGGAAT
TGGCAAAAGTGGGCGGACGCCTTGCTCGCTCATGAGAGTGTTATGGCGAT

Sequences in the Contig:

SY0AAB6YA08FM1