Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB61YP20FM1
Length(NT) : 581
Best Gene Model Blast : Link to GSTUMT00006986001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: FF domain protein
Accession: ref|XP_001268074.1| Score: 435 E_value: 2e-41
KEGG Definition: hypothetical protein
Accession: ang:An11g06730 Score: 427 E_value: 6e-41
KOG Definition:
Classification: [Transcription].
Kog Number: KOG0155 Score: 237 E_value: 4e-21
PFAM Definition: No Hit Found
Swissprot: Q09685|DRE4_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0006260 = Biological process: DNA replication

Sequence:
>SY0AAB61YP20FM1
TTGGAGAATATGCTCAAAAAAGGGTGAAGACTTCAGAACAGGGGCCAGTG
GAGTTTACGGAGGACGATGTGGCCTGGCAATTAGAGGCTATAGCTCAGGA
ATATGGCTTTGATGAGGAGGACCTTGATGAAGGCGAGGAAATGACCGACG
AGGACAACATTTATTTGTTCAAGGAGATGTTGGCCGAATACAAGGTCAAC
CCGTACAGCACTTGGGAGAAAGAAATGCCCCGAATCGTGGAAGACTCTCG
CTACGTCCTAATAAACACAACAAGGGCACGAAAAGGGGTCTTCATAAACT
GGTGCCGAGAGCGTATCGCAGAACTAAAGATCGAGAAGGAGAAGACTAAG
AAGCAGGACCCCAGAATACCCTTCTGGGAATTCCTAAAAGGAAATGCAAG
TGCCAAGTTGTACTGGCCCGAATTCAAGAGAAAATGGAAGAAGTCATCAG
AGATGAAAGCCAGCAAAGTGCCTGACAAAGACAAGGAAAAAATGTATAGA
GAATACATCTCTCATATGAAAATTTCCGAACCCCTCCGTGAAAACGATCT
CAAAAAGCTACTAAGGTCCACCACCACCTTG

Sequences in the Contig:

SY0AAB61YP20FM1