Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB61YP16FM1
Length(NT) : 574
Best Gene Model Blast : Link to GSTUMT00000616001 E-value : 1e-56
Numbers of ESTs : 1

Blast Results:

Nr Definition: ubiquitin-conjugating enzyme type E2
Accession: emb|CAA73327.1| Score: 437 E_value: 9e-42
KEGG Definition: hypothetical protein
Accession: ang:An11g06900 Score: 426 E_value: 8e-41
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0416 Score: 432 E_value: 1e-43
PFAM Definition: UQ_con, Ubiquitin-conjugating enzyme. Proteins destined for proteasome-mediated degradation may be ubiquitinated. Ubiquitination follows conjugation of ubiquitin to a conserved cysteine residue of UBC homologues. TSG101 is one of several UBC homologues that lacks this active site cysteine..
Pfam Number: pfam00179 Score: 242 E_value: 1e-21
Swissprot: Q9P7R4|UBC8_SCHPO
Gene Ontology:
GO:0004842 = Molecular function: ubiquitin-protein ligase activity

Sequence:
>SY0AAB61YP16FM1
TTGGCAACCATCTTCCGCCCGCGCCCGACCATAAATTTACCATTGCTTAA
AACGCCGCACCCGACCCTTCTCTCTGACAGCTCCACACCACTCCCACCAT
ACCAACAGCCGTCCATTATCTTGCGCTGCACACGTCGCTACATAAATAAC
CCCACCTCGGTTCCAACTGTCCTTTCAACCAATCCTCCCTCTTCGCCTCC
CTCCCACAGATCAACGCGGAAGAGCAGTTTCACTTAAGCTACCTAGGGGC
CCGCCGTCATGAGTTCTCCAAAGAGAAGGATAGAGACAGATGTCATGAGT
GATATTCCAGTAATAATAGTTTGCTGACCTTTCTGTTTTCACAGATTGTT
GATGAGCGACTATGAAGTCACTCTTGTCAACGATAACATGCAAGAATTCT
ACGTTCGATTCAAGGGTCCTGAAGAAACGCCTTTTACCGGGGGTATCTGG
AAGGTCCATGTCGAGCTCCCCGATCAATATCCATACAAATCTCCTTCGAT
TGGATTTGTGAATCGCATCTTCCACCCCAATATCGACGAGCTAAGCGGGA
GCGTGTGCTTGGATGTCATCAACC

Sequences in the Contig:

SY0AAB61YP16FM1