Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB61YP08FM1
Length(NT) : 622
Best Gene Model Blast : Link to GSTUMT00007159001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CIMG_04330
Accession: ref|XP_001244889.1| Score: 371 E_value: 5e-34
KEGG Definition: CECR1 family adenosine deaminase, putative
Accession: afm:AFUA_6G13180 Score: 322 E_value: 1e-28
KOG Definition:
Classification: [Nucleotide transport and metabolism].
Kog Number: KOG1097 Score: 105 E_value: 9e-06
PFAM Definition: No Hit Found

Sequence:
>SY0AAB61YP08FM1
TGCCAACTTTGTACAAAAAAGTTGGCACAAAGTTCAGCCGCACTTTGAAC
AAACATCACTACGGTACCGCTGCCTCACCCCACGTTATGGCAAACTCGAT
AGATATCGACATGGACAAGCAGATATCTGAGCATTTGGAGAAGCGGGAGG
CGCTGGTCACTAAAGAGAAGGAGTTCCGGCATGACCATAAATTCCGAAAA
TCCCTCTCGACAACGGCGAAACGTGCCGCGGCAATAGTCTCCCGCATCAG
GCAGCACGAAGCAGAGACAGTATGGACGAAGGAAACCGTGGAGGAAGAAG
GGGACATATACCCCGGTATGATGTTCACTCTTGCTAGGGATCGCATGGAA
ACGACCGAGTTGTGGAAGATTGTGAAGAAGATGCCGAAGGGGTGTCTGTT
ACATGCTCACTTGGAGGCTATGGTTGATATGGATTGGCTGTTTGGGGTTG
CGTTGAGTACGCCTGGGATTCATATATATTCGGATATTCCTCTCACTACG
CCGAAGGCGTTGGAGAAGGCGAATATTCGGTTTACGTATTCTCCTACCAC
ACCGAGGGTGGCTGGCGGGCTCTACTCGTCGCAGTACGAACCTGGGAGTC
TAATCCCGGCGACTGAGGTTGC

Sequences in the Contig:

SY0AAB61YP08FM1