Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB61YM12FM1
Length(NT) : 317
Best Gene Model Blast : Link to GSTUMT00006247001 E-value : 1e-64
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein FG09722.1
Accession: ref|XP_389898.1| Score: 161 E_value: 5e-10
KEGG Definition: conserved hypothetical protein
Accession: fgr:FG09722.1 Score: 161 E_value: 2e-10
KOG Definition:
Classification: [Secondary metabolites biosynthesis, transport and catabolism].
Kog Number: KOG0142 Score: 134 E_value: 1e-09
PFAM Definition: No Hit Found
Swissprot: P15496|IDI1_YEAST
Gene Ontology:
GO:0042802 = Molecular function: identical protein binding

Sequence:
>SY0AAB61YM12FM1
TTGGAGGATGATGACAAAGACGAAAAGCTCTCCTTTACTCCATGGTTCAA
GCTCATTTGCAACACGATGCTCTTTGAGTGGTGGTCGAACTTGGACAATT
TGGATGCCTTCACGAACGAGACTCAGATTAGAAGAATGTAAATCGCATCA
TCTGAGCGCGCATCTATGTCGCTTACCAAATACCCCTATTTGCCATGATC
GCGTACCCCCAGCCGCTACCTTCTTTAGCTACTCTTGCTATCGCTCTTCT
ATATTCTGTATTATATATAATGGTGGGCAGTAGTGAACCATAAATTTGAC
ATTTCTAATTCTTTTTC

Sequences in the Contig:

SY0AAB61YM12FM1