Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB61YL20FM1
Length(NT) : 578
Best Gene Model Blast : Link to GSTUMT00011371001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_03131
Accession: ref|XP_001793713.1| Score: 559 E_value: 6e-56
KEGG Definition: hypothetical protein
Accession: ncr:NCU04669.1 Score: 555 E_value: 9e-56
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q10327|YD72_SCHPO

Sequence:
>SY0AAB61YL20FM1
TTGGACTGACTTCTTTAACGTCTTCCTCCCCCTTGCCATTCAATCAATCC
AATACATCCCGATCCCCCGCCTAACCATCTCAACCCCATCTATAGACCTC
CTGCTAGAAAACCTAATCTTAGAACCGGGAGAGACAATAAACGACTCCTC
CTTCCTCCCCTTCCGCATGCGCATAGAAACCCAAAACGCCCTGGAAATTC
GTAAGGGTCGTTGCAGAGCCTGTTCGTCAATAACCTCCCTTGCGACGATA
AAGCTCGATGGGATATCTCTCCGCGCGGAGGACGTAGGATACTGGCTTCG
TGCACACCACGGCTCGATCATACCGGGATTCACAGACGCGGGCCTAGCCA
GCTTCTCGATCGACAAACGAGGGATAGACCTCCACCTCGATGTGGAGATC
GCCAAAGACCGCATATCAAGCATCCTCTCGCTCCGTGGTGTGCACGTCCA
AATACACAACCTGAACTACACCCTCCGACAATCACGGTTCTCATTCCTGT
CCTGGCTCTTCAAGCCTCTCTTGAGGCGCCTCGTGCGGAGAGCGCTTGAG
CGCGCGATTGCAGAGAATGTTAAAGCTG

Sequences in the Contig:

SY0AAB61YL20FM1