Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB61YK15FM1
Length(NT) : 636
Best Gene Model Blast : Link to GSTUMT00000896001 E-value : 1e-103
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein ATEG_00851
Accession: ref|XP_001210937.1| Score: 168 E_value: 6e-22
KEGG Definition: hypothetical protein
Accession: ncr:NCU00218.1 Score: 152 E_value: 6e-22
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport, Cytoskeleton].
Kog Number: KOG0073 Score: 116 E_value: 6e-07
PFAM Definition: Arf, ADP-ribosylation factor family. Pfam combines a number of different Prosite families together.
Pfam Number: pfam00025 Score: 108 E_value: 4e-06
Swissprot: P36404|ARL2_HUMAN
Gene Ontology:
GO:0005095 = Molecular function: GTPase inhibitor activity
GO:0007021 = Biological process: tubulin folding

Sequence:
>SY0AAB61YK15FM1
TTGGGCAACCGACCGGTTCAGACTCGGCGATTGTAGGACAGAGCTTCATG
GACTTCTCCAGGAGGAGGTTAGTCCCCTCTCCTCTTTCCCATACAAGTTA
TCCTATAGGAGTTTTACCAACAGGAAGCGGGGCAAACAATAGAGGCTCCT
CGGCGCTTCACTTCTGGTGTTCGCTAATAAAACCGATGTCAGCGGTTGTA
TGGCAGAACCCGAAATCACCCAGGTACGCGCTTCCTTATCCTCCCCTACC
TCATCCTCAGTCAATTGATCCATAATAAACCTACGGCACATCATAGGGCC
TCAACCTCAACGATATAAAAACGCATAAATGGGCCATCTTCTCCTGCAGC
GCGATCACTGGGAAGAACATCTCGGAAGGCCTCGACTGGGTCGTCGGCGA
TGCGCAGGAAAGATTATTCCTGTATAACGGGCTGGGCGGTGACCTCGCTA
CTGCTAATACTGTGAAGGGACAGTTGAACTAGTCCAGCTAGCTAGCCCCG
GGAACACAGTAAAATGGATGGCTGTGGTCGTGTTATGTCTGGGGCGGTGG
AGACTCCGAACGTTGTGGTGCCGTAATGAGGGCAGTGGTGATGATGATGC
CCCTTTCACATACCTCATCTAGAGTATTATACCACG

Sequences in the Contig:

SY0AAB61YK15FM1