Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB61YI10FM1
Length(NT) : 481
Best Gene Model Blast : Link to GSTUMT00000895001 E-value : 1e-174
Numbers of ESTs : 1

Blast Results:

Nr Definition: acyl CoA ligase-like protein
Accession: gb|AAP87096.1| Score: 527 E_value: 2e-52
KEGG Definition: hypothetical protein
Accession: mgr:MGG_07705 Score: 478 E_value: 5e-47
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG3628 Score: 237 E_value: 3e-21
PFAM Definition: AMP-binding, AMP-binding enzyme..
Pfam Number: pfam00501 Score: 108 E_value: 3e-06
Swissprot: Q10250|YD22_SCHPO
Gene Ontology:
GO:0000935 = Cellular component: barrier septum
GO:0005819 = Cellular component: spindle

Sequence:
>SY0AAB61YI10FM1
TTGGGTATGAGGGACTGGCTCGGTGGTGAGGAACGGATGGGATGTCCTTT
GCACCAACCGGAGGAGCATGGGGATGGTGAGCCAGAAGAACCAGAGGATG
GCCCAAGCCAGGGAGTAGGAGTTGGGGTCAATGGGTACTCATCATTGCTG
AGCGGTGGTATAACAAAGAAGGCAGACAAAAAGGTGACCGAGCTCACGGA
GGTTTTGCTAGACAAGGAAGCTTTGAAGACCAATGATGTTGTGGTCTTAG
CTGTTGGGGAGGAGGCCCAAAAGAAAGCGGGAGATCCGGGCGCAGTGAGG
GTTGGAGCGTTTGGATACCCTATACCGGATGCTACACTTGCCGTCGTGGA
TCCTGAAACTTTGTTACTCTGTGCTCCGAATGTCATAGGAGAGATATGGG
TTGATTCGCCGTCGCTATCTGGAGGGTTCTGGGCACTCACCAAGCAGACC
GAGAACATATTCCATGCCCGACCTTACAGGT

Sequences in the Contig:

SY0AAB61YI10FM1