Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB61YF19FM1
Length(NT) : 624
Best Gene Model Blast : Link to GSTUMT00010144001 E-value : 1e-117
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CIMG_09275
Accession: ref|XP_001239654.1| Score: 230 E_value: 1e-17
KEGG Definition: hypothetical protein
Accession: ani:AN6914.2 Score: 223 E_value: 3e-17
KOG Definition:
Classification: [Cytoskeleton, Cell cycle control, cell division, chromosome partitioning].
Kog Number: KOG0028 Score: 159 E_value: 5e-12
PFAM Definition: No Hit Found
Swissprot: P05434|CATR_CHLRE
Gene Ontology:
GO:0005515 = Molecular function: protein binding

Sequence:
>SY0AAB61YF19FM1
TTGGAACCTCTCCAACACAAAATGCCTCCGAAGAAACGCTCTCGCGCAAG
CAGAGCTTCAAAGCTATTAGTAGAGCTAGATCTAACACCCGAAGAGGAAG
AAGAGGTCGCAGAGGTGTGGTCAATGTACGTTGACGGGGACGCCTCAGAG
GACATTGGTGAAGAAGTGATTGCCGCAAAGGACGTTAGGAGAGTCTTGAT
GTAAGCTCTGATCCTATACACTGTACCTTATTGAAGACCATAGCGACTGT
GTAATACCGTAGGGGCATGGGATTCGAGTCTTCAAAAGAGGAAATGAACG
AGATACTCGAAATTGTCGACCCGGATGACGAGGGCTGGGTCACCTATGAG
AGGTTCCTACCGGTTGCGTCGTTGAAGTTGAAAGAAGCCGAGAAAGCATT
CCAAATATTTACTGCCGGCCAACCCGGCCCTATCACTATGGAGCACTTGA
GGCGTGTTGCTGAGCGACTCAAAGAAGATGTTACGGATGATCAGTTAAGG
GAGATGCTCGCGGTAGCCTGCACAAAGGAGATCAGTAGAGGCGTGGACCT
GAATGATTTCCAAGCGGTAATGAAGCGGGCTGGTGTCTTATGATAAACTA
TTATGCTATGCTCTGGGGATTTCT

Sequences in the Contig:

SY0AAB61YF19FM1