Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB61YF01FM1
Length(NT) : 401
Best Gene Model Blast : Link to GSTUMT00010175001 E-value : 1e-129
Numbers of ESTs : 1

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Transcription].
Kog Number: KOG4479 Score: 108 E_value: 2e-06
PFAM Definition: No Hit Found

Sequence:
>SY0AAB61YF01FM1
ACCATACCAAACCCCTCCCCCCCCCAAATCGCCACCACGCCCAAAAAAAA
CCCCGCCAAGATGTCCCAGGACACTACCTTACGCGCGGAGGTGAACCGCC
GCCTTCTAGAATCCGGGGAGCTTGAACGCCTAGAAGCGCTCTTCCTGGAC
CTCCTGAGGGAGTCCGGCTGGTACGAGAACACGAGGAATACGTGCGCGGA
GAAGCTGCGCAGCGGGGAATTGGCCGGCGGCGGATTCAATCGACTTACGG
AGGAGGTGGAACGGGAGTGTCGGGAGAAGGTGCCCGAGGAGGTGAGGGTT
GAGATGGTTAAGGCTATCAAGAAGGTTTTGGAGGGGATGGTTGAGGGATG
AGTGATAATTGGAATTTGAAGGGGAGGGGGGGTTTCCCTTTTTCGATCTT
T

Sequences in the Contig:

SY0AAB61YF01FM1